Obtaining cloned fragments upstream or downstream of existing cloned genomic DNAs can be a difficult process. Screening of genomic libraries is the traditional way to proceed, but the A+T-rich DNA of hydrozoans, which shows instability in lambda phage genomic libraries, complicates this approach. Various PCR approaches can be used to extend the cloned region. These methods include inverse PCR and vectorette PCR. These two approaches have been used successfully with Hydra .
An improvement on the vectorette approach is the so-called "splinkerette" method . Several labs have been using the splinkerette approach with Hydra genes with considerable success. The protocol which the Steele lab uses is given below. You can also download the protocol as a PDF file by clicking here.
References:
Splinkerette Protocol
Nick Stover, UC Irvine , 5-17-01
Purpose: To obtain genomic sequence upstream or downstream of a known sequence.
This protocol has been modified from its original form, published by Devon, Porteous, and Brookes in Nucleic Acids Research 1995, vol. 23, 1644-1645. In this paper the authors cleaved genomic DNA with BamHI and used an adapter sequence that recognizes the BamHI overhang. Since BamHI cuts too infrequently in Hydra's A+T-rich genome, I have changed the oligos to take advantage of more A+T-rich sites (EcoRI, HindIII, and XbaI). These change the overhang and bases at the end of the splnktop oligo; however, all the bottom strand oligos work with it and a new splnktop primer is not required. The oligos I use are:
splnktop cgaatcgtaaccgttcgtacgagaattcgtacgagaatcgctgtcctctccaacgagccaaga
splkO cgaatcgtaaccgttcgtacgagaa
splkI tcgtacgagaatcgctgtcctctcc
splnkhind agcttcttggctcgtttttttttgcaaaaa
splnkecoI aatttcttggctcgtttttttttgcaaaaa
splnkxba ctagtcttggctcgtttttttttgcaaaaa
Here is a protocol using HindIII as the cleaving enzyme:
Mix the proper amounts of splinktop and splnkhind oligo (150 µg/ml each) in 20 µl of Tris, pH 7.4 and 5 mM MgCl2. Heat the mixture to 90°C, then cool on the benchtop for 10-20 minutes. Digest a few µg of genomic DNA with HindIII in a 20 µl reaction, then heat inactivate the enzyme at 65°C for 10 minutes. Carry out a ligation as follows:
6 µl annealed splinker (prepared as described above)
2 µl from the HindIII-digested DNA reaction (prepared as described above)
10 µl 2X ligase buffer (or 2 µl of 10X buffer)
1µl water (or 9 µl if 10X ligase buffer is used)
1µl T4 DNA ligase
Incubate at 15°C overnight.
Perform a standard three step PCR reaction with an annealing temperature which is 5°C below the gene-specific primer's Tm. Repeat the PCR with the internal primers. Run the products in a 1.0% agarose gel. Your band of interest should be nice and fat. Cut this nice fat band out of the gel and clone into a TA cloning vector.
You might want to consider running this procedure using the splnkxba and splnkeco (or the splnkbam used by Devon et al., if your genome is G+C-rich) in parallel. That way you're sure to get some positives, and if the HindIII site is only 50 bases past your known sequence, you won't have to do it again. Also, if you want to get past those 50 bases, you'll have to use another restriction enzyme anyway.
If you have questions, you can e-mail Nick at nastover@uci.edu.